Journal of Hepatology
Volume 42, Issue 1 , Pages 117-123, January 2005

Overexpression of thioredoxin prevents thioacetamide-induced hepatic fibrosis in mice

  • Hiroaki Okuyama

      Affiliations

    • Department of Gastroenterological Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan
    • ,
  • Hajime Nakamura

      Affiliations

    • Department of Experimental Therapeutics, Translational Research Center, Kyoto University, Kyoto, Japan
    • ,
  • Yasuyuki Shimahara

      Affiliations

    • Department of Gastroenterological Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan
    • ,
  • Naoki Uyama

      Affiliations

    • Department of Gastroenterological Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan
    • ,
  • Yong-Won Kwon

      Affiliations

    • Department of Biological Responses, Laboratory of Infection and Prevention, Institute for Virus Research, Kyoto University, 53, Shogoin, Kawahara-cho, Sakyo-ku, Kyoto 606-8505, Japan
    • ,
  • Norifumi Kawada

      Affiliations

    • Department of Hepatology, Graduate School of Medicine, Osaka City University, Osaka, Japan
    • ,
  • Yoshio Yamaoka

      Affiliations

    • Department of Gastroenterological Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan
    • ,
  • Junji Yodoi

      Affiliations

    • Department of Biological Responses, Laboratory of Infection and Prevention, Institute for Virus Research, Kyoto University, 53, Shogoin, Kawahara-cho, Sakyo-ku, Kyoto 606-8505, Japan
    • Corresponding Author InformationCorresponding author. Tel.: +81 75 751 4024; fax: +81 75 761 5766.

Received 2 May 2004; received in revised form 9 September 2004; accepted 21 September 2004. published online 18 October 2004.

Article Outline

Background/Aims

Thioredoxin is a small redox-active protein with anti-oxidant and anti-apoptotic effects. We have previously reported that thioacetamide-induced acute hepatitis was attenuated in thioredoxin transgenic mice. The aim of the present study was to investigate the protective effect of thioredoxin for hepatic fibrosis.

Methods

We subjected thioredoxin transgenic mice to thioacetamide-induced hepatic fibrosis. We also studied the effect of thioredoxin on the activation process of primary-cultured hepatic stellate cell.

Results

The expression of endogenous thioredoxin was induced in hepatocytes of thioacetamide-induced murine and rat fibrotic livers. Overexpression of thioredoxin inhibited tumor necrosis factor-α-induced apoptosis of HepG2 cells. Thioacetamide-induced fibrosis and accumulation of malondialdehyde were suppressed in transgenic mice as compared with wild type mice. Hepatic stellate cells isolated from transgenic mice were less proliferative than those isolated from wild type mice. Recombinant thioredoxin significantly inhibited DNA synthesis of primary-cultured stellate cells under serum or platelet-derived growth factor stimulation.

Conclusions

Thioredoxin has a potential to attenuate hepatic fibrosis via suppressing oxidative stress and inhibiting proliferation of stellate cells.

Keywords: Thioredoxin, Hepatic fibrosis, Stellate cell

Abbreviations: ADF, adult T cell leukemia-derived factor, ALT, alanine aminotransferase, AP-1, activator protein-1, AST, aspartate aminotransferase, CHX, cycloheximide, DMEM, Dulbecco's modified eagle medium, EB, Epstein–Barr, ERK, extracellular signal-regulated kinase, FBS, fetal bovine serum, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, HIV, human immunodeficiency virus, H2O2, hydrogen peroxide, hTrx, human thioredoxin, HSC, hepatic stellate cell, IL, interleukin, LPS, lipopolysaccharide, MDA, malondialdehyde, mTrx, mouse thioredoxin, MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt, NAC, N-acetylcysteine, NF-κB, nuclear factor-κB, PAGE, polyacrylamide gel electrophoresis, PBS, phosphate-buffered saline, PDGF, platelet-derived growth factor, PDTC, pyrrolidine dithiocarbamate, Ref-1, redox factor-1, ROS, reactive oxygen species, SDS, sodium dodecylsulfate, SMA, smooth muscle α-actin, TAA, thioacetamide, Tg, transgenic, TNF, tumor necrosis factor, Trx, thioredoxin, WT, wild type

 

Back to Article Outline

1. Introduction 

Oxidative stress contributes to the pathogenesis of hepatic fibrosis induced by alcohol and virus infection [1], [2]. Hepatic stellate cell (HSC), a liver-specific pericyte, plays a central role in liver fibrogenesis [3], [4]. Oxidative stress induces the proliferation of HSC and enhances the collagen synthesis. Hence, anti-oxidants, such as pyrrolidine dithiocarbamate (PDTC) and N-acetylcysteine (NAC), attenuate HSC activation and improve hepatic fibrosis [5], [6].

Thioredoxin (Trx) is an endogenous multifunctional protein with a redox-active disulfide/dithiol within the conserved active site sequence: -Cys-Gly-Pro-Cys- [7]. The two cysteine residues at the active site, Cys-32 and Cys-35, undergo reversible oxidation–reduction reactions catalyzed by a NADPH-dependent enzyme thioredoxin reductase. We originally cloned human Trx (hTrx) as adult T cell leukemia-derived factor (ADF) produced by human T cell leukemia virus type-I-transformed T cells [8], [9].

Trx attenuates focal ischemic brain damage by scavenging reactive oxygen species (ROS) in Trx transgenic (Tg) mice [10]. Tg mice exhibit extended median and maximum life spans compared with wild type (WT) mice [11]. Pancreatic beta cell-specific expression of Trx prevents autoimmune and streptozotocin-induced diabetes [12]. Trx inhibits infection by human immunodeficiency virus (HIV) in T cells, influenza virus in mice, and Epstein–Barr (EB) virus in B and T cells [13], [14], [15].

Based on accumulating evidence, we hypothesized that Trx could attenuate hepatic fibrosis through preventing parenchymal and non-parenchymal cells from continuous damage induced by a chemical hepatotoxin. In order to clarify the protective mechanism of Trx for hepatic fibrosis, we subjected C57BL/6 wild type and Tg mice to thioacetamide (TAA)-induced hepatic fibrosis.

Back to Article Outline

2. Materials and methods 

2.1. Reagents 

hTrx and mouse Trx (mTrx) proteins were detected by immunohistochemistry and immunoblotting using anti-hTrx monoclonal antibody (ADF 11-mAb) and anti-mTrx polyclonal antibodies (Redox Bioscience, Inc., Kyoto, Japan), respectively, as previously described [10]. Human recombinant Trx was prepared as described previously [16] and provided by Ajinomoto, Inc. (Kawasaki, Japan). Unless specifically indicated, all other reagents were purchased from Sigma (St. Louis, MO).

2.2. Animals 

The generation and maintenance of C57BL/6 Tg mice was described previously [10]. In Trx Tg mice, hTRX cDNA was inserted between the β-actin promoter and the β-actin terminator. Tg mice were provided by Ajinomoto, Inc. (Kawasaki, Japan). The protocol of animal experiments was approved by the recommendations of the institutional animal care committee.

2.3. Thioacetamide-induced rat and murine hepatic fibrosis 

Male Wistar rats aged 6–8 weeks and male C57BL/6 mice weighing 25–30g were used for an in vivo hepatic fibrosis model. In a rat fibrosis model, TAA (100μg/g) was injected intraperitoneally twice a week for 9 weeks into two rats for the immunohistochemistry of Trx [6]. In a murine fibrosis model, TAA was injected intraperitoneally three times a week for 3 months into WT (n=5) and Tg (n=5) mice. In this model, the dose of TAA was 100μg/g, except in the first time the dose of TAA was 50μg/g.

2.4. Isolation and culture of murine and rat hepatic stellate cells 

HSC were obtained from murine and rat livers as previously described [6]. Briefly, murine and rat livers were digested with 0.1% pronase E (Merck, Darmstadt, FRG) and 0.04% collagenase (Wako Pure Chemical Co., Osaka, Japan). The digested liver was centrifuged on an 8.2% Nycodenz (Nycomed Pharm AS, Oslo, Norway) cushion. The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL). Cell purity was always more than 95% as assessed by a typical star-like configuration and by detecting vitamin A autofluorescence.

2.5. Generation of stable transfectants in HepG2 cell line 

HepG2 cells were transfected with pcDNA3-TRXwild type or double mutant (C32S/C35S), pcDNA3 control (Invitrogen, Carlsbad, CA) vector using FuGENE6 (Roche Molecular Biochemicals, Indianapolis, IN) following the manufacturer's instructions. Transfected cells were cultured in fresh medium containing 1mg/ml G418 (Nacalai Tesque, Inc, Kyoto, Japan). The stable transfectants were obtained by selection for G418 resistance and confirmed by Western blotting analysis. To avoid clonal variation, two selected clones were tested.

2.6. Detection of cytotoxicity by MTS assay 

Stable transfectants of Trx in HepG2 cell line were incubated with tumor necrosis factor (TNF)-α (1–100U) plus cycloheximide (CHX) (30μM) for 24h. We added 20μl of the CellTiter 96 Aqueous One Solution Reagent (Promega, Madison, WI), and then recorded its absorbance at 490nm.

2.7. Flow cytometry 

Stable transfectants of Trx in HepG2 cell line were incubated with TNF-α (100U) plus CHX (30μM) for 8h. After 8h the cells were treated with 50μg/ml propidium iodide (Calbiochem, La Jolla, CA) and analyzed by flow cytometry FACScan (Becton Dickenson, Franklin Lakes, NJ) using the software Cell Quest (Becton Dickenson). The position of the cells with sub-G1 DNA content is indicative of apoptosis.

2.8. [3H] Thymidine incorporation 

Rat HSC were preincubated with recombinant Trx (1 and 10μM) for 24h at 37°C and then incubated with 1.0μCi/ml [3H] thymidine (Amersham Pharmacia Biotech, Piscataway, NJ) for another 24h at 37°C.

2.9. Western blotting 

The samples of the livers of WT and Tg mice were homogenized in 1× sample buffer (62.5mM Tris–HCl, pH 6.8, 10% glycerol, 2% sodium dodecylsulfate (SDS), 5% 2-mercaptoethanol, 1mM Na3VO4). Rat HSC were also lysed by 1× sample buffer. Ten micrograms of samples were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) (7.5–15%) and then transferred onto an Immobilon P membrane (Millipore Corp., Bedford, MA).

2.10. Northern blotting 

We extracted total RNA of HSC isolated from WT and Tg mice using Isogen (Nippon Gene, Tokyo, Japan). Total RNA (5μg) was separated on a 1% agarose gel (Nippon Gene) and transferred onto a nylon membrane (Hybond-N+; Amersham Pharmacia Biotech). The membrane was incubated with polymerase chain reaction-amplified double-stranded cDNAs at 42°C overnight. The following primers were used: collagen α 1 type I, 5′- TGCCGTGACCTCAAGATGTG -3′ (forward) and 3′-CACAAGCGTGCTGTAGGTGA-5′ (reverse); glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′-ACCACAGTCCATGCCATCAC-3′ (forward) and 3′-TCCACCACCCTGTTGCTGTA-5′ (reverse). Identification of amplified DNAs was confirmed by sequencing.

2.11. Histological analysis 

We stained the paraffin-embedded sections (4μm thickness) with Mallory azan, followed by morphometric analysis of fibrotic area using Mac SCOPE version 2.5 (MITANI Corp, Shizuoka, Japan). Ten non-overlapping areas were evaluated in each group.

2.12. Detection of lipid peroxidation 

For the determination of lipid peroxidation, we measured the content of hepatic malondialdehyde (MDA) using the thiobarbituric acid method [17]. Its absorbance was measured at 532nm.

2.13. Statistical analysis 

Data presented as bar graphs are the means±SD of three independent experiments except for in vivo analysis of more than five independent experiments. Statistical analysis was performed by Student's t test (P<0.05 was considered significant).

Back to Article Outline

3. Results 

3.1. Upregulation of endogenous Trx in parenchymal cells of murine and rat hepatic fibrosis 

Hepatic fibrosis was induced in murine and rat liver by TAA administration. Immunohistochemistry showed that the expression of Trx was upregulated in parenchymal cells of TAA-treated fibrotic liver as compared with non-parenchymal cells in fibrotic septa (Fig. 1A–D).

  • View full-size image.
  • Fig. 1. 

    Upregulation of endogenous Trx in TAA-induced murine and rat hepatic fibrosis. Immunohistochemical staining for Trx in normal murine liver (A), TAA-induced murine fibrotic liver (B), normal rat liver (C) and TAA-induced rat fibrotic liver (D). Endogenous Trx expression was increased in hepatocytes of TAA-treated murine and rat fibrotic liver (B and D). Magnification, ×200.

3.2. Inhibitory effect of Trx on TNF-α-induced cell death in HepG2 cell line 

We overexpressed human wild type or double mutant Trx (C32S/C35S) in HepG2 cell line (Fig. 2A). TNF-α plus CHX-induced death of HepG2 cells was detected by MTS assay. Overexpression of wild type Trx attenuated TNF-α plus CHX-induced death of HepG2 cells. In contrast, double mutant Trx enhanced TNF-α plus CHX-induced cell death (Fig. 2B), which suggests that TRX may play a protective role for inflammation-associated cell death of hepatoblastoma-derived HepG2 cells. In addition, we checked the effect of Trx on apoptosis using HepG2 treated by TNF-α plus CHX for 8h by FACS analysis of DNA fragmentation (Fig. 2C). Transfection of wild type Trx but not double mutant Trx significantly inhibited apoptosis of HepG2 cells.

  • View full-size image.
  • Fig. 2. 

    Effect of Trx in TNF-α-induced apoptosis of HepG2 cells. (A) Western blotting of stable Trx transfectants of HepG2 cells. EV indicates empty vector. Trx wt indicates wild type Trx. Trx dm indicates double mutant Trx. Trx is overexpressed in Trx wt HepG2 cells. This antibody recognizes double mutant Trx as well. (B) Determination of viable number of HepG2 cells treated with TNF-α plus CHX by MTS assay. Cell death was significantly inhibited in Trx wt HepG2 cells (solid line) compared with control (dotted line) (*P<0.05). Cell death was significantly enhanced in Trx dm HepG2 cells (grey line) compared with control (*P<0.05). (C) Flow cytometry analysis of DNA fragmentation in stable Trx transfectants of HepG2 cells treated with TNF-α plus CHX. Apoptosis was significantly inhibited in Trx wt HepG2 cells (black bar) compared with control (white bar) (*P<0.05). There was no difference in apoptosis between Trx dm HepG2 cells (hatched bar) and control (white bar).

3.3. Attenuation of thioacetamide-induced hepatic fibrosis in Tg mice 

Both WT and Tg mice were subjected to hepatic fibrosis caused by long-term TAA administration. Histological analysis by Azan staining showed that TAA induced fibrosis in the liver of WT mice (Fig. 3A and C). In contrast, fibrotic area was not prominent in the liver of TAA-treated Tg mice (Fig. 3B and D). Image analysis confirmed that there was a significant difference in TAA-induced fibrotic area between WT and Tg mice (*P<0.05, Fig. 3E).

  • View full-size image.
  • Fig. 3. 

    Trx inhibited TAA-induced hepatic fibrosis. (A–D). Azan staining. (A) Non-treated WT mouse liver. (B) Non-treated Tg mouse liver. (C) TAA-treated WT mouse liver. (D) TAA-treated Tg mouse liver. Fibrosis is apparent in TAA-treated WT mouse liver (C). Fibrosis is hardly detected in TAA-treated Tg mouse liver (D). Magnification, ×100. (E) Evaluation of fibrotic area observed by Azan staining. We used image analysis soft Mac Scope. *P<0.05. (F) MDA content in the liver. MDA was measured at the absorbance of 532nm. *P<0.05 (G and H). Serum level of AST (G) and ALT (H) after TAA administration for 3 months.

Oxidative stress contributes to the pathogenesis of hepatic fibrosis. In order to clarify the inhibitory mechanism of Trx against hepatic fibrosis, we checked whether Trx inhibits TAA-induced oxidative stress. Lipid peroxidation was estimated by measuring the level of MDA in the liver. The level of MDA in the liver of TAA-treated Tg mice was significantly less than that in the liver of TAA-treated WT mice (*P<0.05, Fig. 3F).

Serum levels of alanine (ALT) and aspartate aminotransferase (AST) were lower, although not significant, in Tg mice than in WT mice (AST, P=0.0644; Fig. 3G, and ALT, P=0.0586; Fig. 3H).

3.4. Trx inhibits the proliferation of primary-cultured hepatic stellate cell 

HSC from WT mice expressed endogenous mTrx, while HSC from Tg mice expressed not only endogenous mTrx but also hTrx (Fig. 4A). In HSC isolated from WT and Tg mice, the expressions of PDGF receptor and SMA in WT mice were same with them in Tg mice (Fig. 4A). We could not detect any difference of the morphology in HSC isolated from WT and Tg mice (Fig. 4B).

  • View full-size image.
  • Fig. 4. 

    Effect of Trx on serum- and PDGF-stimulated proliferation of primary-cultured HSC. (A) Western blot. Samples were prepared from HSC that were isolated from WT and Tg mice and cultured for the indicated days. hTrx, human Trx. mTrx, mouse Trx. HSC isolated from Tg mice express hTrx. (B) The morphology of HSC isolated from WT and Tg mice. Upper left: quiescent HSC isolated from WT mice and cultured for 1 day. Upper right: quiescent HSC isolated from Tg mice and cultured for 1 day. Lower left: activated HSC isolated from WT mice and cultured for 7 days. Lower right: activated HSC isolated from Tg mice and cultured for 7 days. (C) The number of cultured HSC isolated from WT and Tg mice. Cell number was determined at the indicated days by Trypan blue staining. (D) Effect of human recombinant Trx on serum-stimulated DNA synthesis of activated rat HSC. *P<0.01. (E) Effect of recombinant human Trx on PDGF-dependent DNA synthesis of activated rat HSC. *P<0.05. (F) Expression of phospho-specific ERK, total ERK, phospho-specific Akt, and total Akt in activated rat HSC treated with recombinant Trx (10μM) and PDGF-BB (20μg/ml). After culture for 5 days, rat HSC were preincubated with 10μM of recombinant Trx suspended in sterile phosphate buffer saline (PBS) for 24h at 37°C and then incubated with 20μg/ml of PDGF-BB for 10min at 37°C. (G) Expression of collagen type I alpha 1 mRNA in HSC that were isolated from WT and Tg mice and treated with 10μM of TGF-β for 24h after culture for 5 days.

We checked the effect of Trx on proliferation. HSC from WT and Tg mice gradually increased in number on the plastic dishes after plating. By trypan blue staining, the number of HSC from Tg mice was less than that of HSC from WT mice at day 7 after plating (P=0.0503, Fig. 4C). Under serum deprivation, thymidine uptake of activated rat HSC retained to be about 4000cpm/well (Fig. 4E). Supplementation of serum increased thymidine uptake of activated rat HSC up to 6000cpm/well (Fig. 4D). Supplementation of recombinant Trx significantly inhibited serum-stimulated DNA synthesis of activated rat HSC (*P<0.05, Fig. 4D). In addition, recombinant Trx significantly inhibited PDGF-dependent DNA synthesis of activated rat HSC (*P<0.05, Fig. 4E) without affecting PDGF-dependent ERK and Akt phosphorylation (Fig. 4F). These results indicate that recombinant Trx inhibited serum- and PDGF-dependent HSC proliferation.

As for collagen synthesis, there was no difference between HSC isolated from WT and Tg mice in TGF-β-dependent collagen α1(I) mRNA expression (Fig. 4G).

Back to Article Outline

4. Discussion 

Trx inhibits TAA-induced acute hepatitis and ethanol-induced hepatocyte damage via its anti-oxidative action [17], [18]. In the present study, we showed that overexpression of wild type Trx attenuated TNF-α-induced cell death. These results indicate that wild type Trx transfected HepG2 cells inhibit TNF-α-induced cell death by blocking apoptosis. Kondo et al. reported that Jurkat cells transfected with wild type Trx showed 9.4% apoptosis and the cells transfected with control vector showed 15.5% apoptosis after the addition of hydrogen peroxide (H2O2) [19]. In primary hepatocyte, Tsutsui et al. showed that adenovirus containing wild type Trx gene suppressed primary hepatocyte apoptosis [20]. These reports are in line with the present result. Previous report showed that the transfection of double mutant Trx inhibits p53-dependent p21 activation which is accelerated by endogenous Trx [21]. The effect of double mutant Trx transfection on the cellular survival and apoptosis is further to be analyzed.

We already reported that Trx inhibited apoptosis in TAA-induced acute hepatitis liver [17]. We also checked the effect of Trx on apoptosis in chronic hepatic fibrosis liver. However, we could not detect any apoptosis signal in chronic fibrotic livers of both WT and Tg mice by TUNEL staining (data not shown). This result indicates that Trx might inhibit hepatic fibrosis through blocking proliferation of HSC rather than blocking apoptosis of hepatocytes in a chronic fibrosis model.

In this study, we showed that recombinant Trx has an inhibitory effect on the proliferation of HSC stimulated by serum and PDGF. However, we could not detect any effect of recombinant Trx on PDGF-stimulated phosphorylation of Akt and ERK. It means that recombinant Trx inhibits PDGF-dependent proliferation through its direct interaction with other signaling molecules. Trx regulates the activation of transcription factors such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1) and redox factor-1 (Ref-1) [22], [23], [24]. We previously reported that Trx inhibited p38 signal [25]. It is possible that Trx might inhibit PDGF-dependent proliferation through blocking of p38 signal in HSC.

Oxidative stress is involved in HSC activation and promotion of their proliferation, collagen synthesis and migration. In fact, anti-oxidants including vitamin E inhibits proliferation and collagen synthesis of HSC [26]. We showed that Trx inhibited proliferation of HSC in primary culture (Fig. 4B–D). This may explain, at least in part, the mechanism how Trx suppresses hepatic fibrosis. Although Trx failed to inhibit collagen mRNA expression in HSC (Fig. 4F), we have recently reported that Trx directly interact with C-propeptide region of human pro α 1 type 1 collagen (CP-pro α 1(1)) [27]. Trx might regulate maturation or degradation of collagen fibers at post-transcriptional level.

Trx is a stress-inducible protein whose expression is enhanced by various types of stresses, e.g. viral infection, exposure to UV light, X-ray irradiation, and H2O2 [10]. TAA is known to cause hepatic fibrosis by the production of free radicals in the liver. We showed that Trx expression was enhanced in parenchymal cells of TAA-treated murine and rat livers (Fig. 1). Actually, serum level of Trx is elevated in hepatitis C virus infection [28]. Based on these results, it is speculated that Trx might be released from hepatocytes in the TAA-treated livers. Recently, Kondo et al. reported that recombinant Trx can go through the cell membrane into the cytosol, resulting in scavenging intracellular ROS [19]. Serum level of hTrx in Tg mice is more than 100ng/ml which is roughly 5–10 fold higher than normal level of Trx in human sera [25]. It is suggested that the suppression of TAA-induced hepatic fibrosis in Tg mice might be due to high levels of circulating hTrx.

In summary, we showed that Trx has the inhibitory effect on HSC proliferation in vitro, and TAA-induced hepatic fibrosis in vivo. This qualifies Trx as a promising candidate for the treatment of hepatic fibrosis caused by alcohol and virus infection.

Back to Article Outline

Acknowledgements 

We thank Shinichi Araya (Department of Biological Responses, Institute for Virus Research, Kyoto University) for supplying transgenic mice and C57BL/6 wild type mice, and Drs Norihiko Kondo and Hiroshi Masutani (Department of Biological Responses, Institute for Virus Research, Kyoto University) for critical discussion. This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

Back to Article Outline

References 

  1. Kurose I, Higuchi H, Miura S, Saito H, Watanabe N, et al. Oxidative stress-mediated apoptosis of hepatocytes exposed to acute ethanol intoxication. Hepatology. 1997;25:368–378
  2. Lieber CS. Alcohol and hepatitis C. Alcohol Res Health. 2001;25:245–254
  3. Friedman SL. The cellular basis of hepatic fibrosis. Mechanisms and treatment strategies. N Engl J Med. 1993;328:1828–1835
  4. Okuyama H, Shimahara Y, Kawada N. The hepatic stellate cell in the post-genomic era. Histol Histopathol. 2002;17:487–495
  5. Bruck R, Hussein A, Schey R, Matas Z, Reifen R, Zaiger G, et al. Pyrrolidine dithiocarbamate protects against thioacetamide-induced fulminant hepatic failure in rats. J Hepatol. 2002;36:370–377
  6. Okuyama H, Shimahara Y, Kawada N, Seki S, Kristensen DB, Yoshizato K, et al. Regulation of cell growth by redox-mediated extracellular proteolysis of platelet-derived growth factor receptor β. J Biol Chem. 2001;276:28274–28280
  7. Holmgren A. Thioredoxin. Annu Rev Biochem. 1985;54:237–271
  8. Tagaya Y, Maeda Y, Mitsui A, Kondo N, Matsui H, Hamuro J, et al. ATL-derived factor (ADF), an IL-2 receptor/Tac inducer homologous to thioredoxin; possible involvement of dithiol-reduction in the IL-2 receptor induction. EMBO J. 1989;8:757–764
  9. Yodoi J, Tursz T. ADF: a growth-promoting factor derived from adult T-cell leukemia and homologous to thioredoxin; involvement in lymphocyte immortalization by HTLV-I and EBV. Adv Cancer Res. 1991;57:381–411
  10. Takagi Y, Mitsui A, Nishiyama A, Nozaki K, Sono H, Gon Y, et al. Overexpression of thioredoxin in transgenic mice attenuates focal ischemic brain damage. Proc Natl Acad Sci USA. 1999;96:4131–4136
  11. Mitsui A, Hamuro J, Nakamura H, Kondo N, Hirabayashi Y, Ishizaki-Koizumi S, et al. Overexpression of human thioredoxin in transgenic mice controls oxidative stress and life span. Antioxid Redox Signal. 2002;4:693–696
  12. Hotta M, Tashiro F, Ikegami H, Niwa H, Ogihara T, Yodoi J, et al. Pancreatic β cell-specific expression of thioredoxin, an antioxidative and antiapoptotic protein, prevents autoimmune and streptozotocin-induced diabetes. J Exp Med. 1998;188:1445–1451
  13. Nakamura H, Masutani H, Yodoi J. Redox imbalance and its control in HIV infection. Antioxid Redox Signal. 2002;4:455–464
  14. Nakamura H, Tamura S, Watanabe I, Iwasaki T, Yodoi J. Enhanced resistancy of thioredoxin-transgenic mice against influenza virus-induced pneumonia. Immunol Lett. 2002;82:165–170
  15. Nishinaka Y, Nakamura H, Okada N, Okada H, Yodoi J. Redox control of EBV infection: prevention by thiol-dependent modulation of functional CD21/EBV receptor expression. Antioxid Redox Signal. 2001;3:1075–1087
  16. Tagaya Y, Wakasugi H, Masutani H, Nakamura H, Iwata S, Mitsui A, et al. Role of ATL-derived factor (ADF) in the normal and abnormal cellular activation: involvement of dithiol related reduction. Mol Immunol. 1990;27:1279–1289
  17. Okuyama H, Nakamura H, Shimahara Y, Araya S, Kawada N, Yamaoka Y, et al. Overexpression of thioredoxin prevents acute hepatitis caused by thioacetamide or lipopolysaccharide in mice. Hepatology. 2003;37:1015–1025
  18. Hirota K, Nakamura H, Arai T, Ishii H, Bai J, Itoh T, et al. Geranylgeranylacetone enhances expression of thioredoxin and suppresses ethanol-induced cytotoxicity in cultured hepatocytes. Biochem Biophys Res Commun. 2000;275:825–830
  19. Kondo N, Ishii Y, Kwon YW, Tanito M, Horita H, Nishinaka Y, et al. Redox-sensing release of human thioredoxin from T lymphocytes with negative feedback loops. J Immunol. 2004;172:442–448
  20. Tsutsui T, Koide H, Fukahori H, Isoda K, Higashiyama S, Maeda I, et al. Adenoviral transfection of hepatocytes with the thioredoxin gene confers protection against apoptosis and necrosis. Biochem Biophys Res Commun. 2003;307:765–770
  21. Ueno M, Masutani H, Arai RJ, Yamauchi A, Hirota K, Sakai T, et al. Thioredoxin-dependent redox regulation of p53-mediated p21 activation. J Biol Chem. 1999;274:35809–35815
  22. Takeuchi J, Hirota K, Itoh T, Shinkura R, Kitada K, Yodoi J, et al. Thioredoxin inhibits tumor necrosis factor- or interleukin-1-induced NF-kappaB activation at a level upstream of NF-kappaB-inducing kinase. Antioxid Redox Signal. 2000;2:83–92
  23. Hirota K, Matsui M, Iwata S, Nishiyama A, Mori K, Yodoi J. AP-1 transcriptional activity is regulated by a direct association between thioredoxin and Ref-1. Proc Natl Acad Sci USA. 1997;94:3633–3638
  24. Hirota K, Murata M, Sachi Y, Nakamura H, Takeuchi J, Mori K, et al. Distinct roles of thioredoxin in the cytoplasm and in the nucleus. J Biol Chem. 1999;274:27891–27897
  25. Nakamura H, Herzenberg LA, Bai J, Araya S, Kondo N, Nishinaka Y, et al. Circulating thioredoxin suppresses lipopolysaccharide-induced neutrophil chemotaxis. Proc Natl Acad Sci USA. 2001;98:15143–15148
  26. Chojkier M, Houglum K, Lee KS, Buck M. Long- and short-term d-alpha-tocopherol supplementation inhibits liver collagen alpha1(I) gene expression. Am J Physiol. 1998;275:G1480–G1485
  27. Matsumoto K, Masutani H, Nishiyama A, Hashimoto S, Gon Y, Horie T, et al. C-propeptide region of human pro α 1 type 1 collagen interacts with thioredoxin. Biochem Biophys Res Commun. 2002;295:663–667
  28. Sumida Y, Nakashima T, Yoh T, Nakajima Y, Ishikawa H, Mitsuyoshi H, et al. Serum thioredoxin levels as an indicator of oxidative stress in patients with hepatitis C virus infection. J Hepatol. 2000;33:616–622

PII: S0168-8278(04)00430-1

doi:10.1016/j.jhep.2004.09.020

Journal of Hepatology
Volume 42, Issue 1 , Pages 117-123, January 2005

Article Tools

* Image Usage & Resolution